AUGGUUCAAUCGCAGACUUGUAACAGAUUUACGUAC I dream about eat(ing) pizza before Anthropology class in school. The sentence seems correct but maybe it could have been "at school" instead of "in school". And also you didn't put a random base at the start or the end of your DNA strand. It was very easy for me to locate the start and stop codon.
Hello Johnesha, You are correct the sentence is I dream about pizza before Anthropology class in school and yeah i made a mistake by not reading the last part of the assignment if i had i would've added more bases before and after the strand. Thanks for the feedback!
Brian, the coding is good. As noted by Johnesha, you just left off that last set of instructions to include random bases. That was designed to make your decoder look for the start/stop codons to know where to begin and end the translation process. You just made it too easy to decode!
Here is my decode for reference:
DNA: TACCAAGTTAGCGTCTGAACATTGTCTAAATGCATC RNA/Codons: AUG GUU CAA UCG CAG ACU UGU AAC AGA UUU ACG UAG (start) I dream about eat(ing) pizza before anthropology class in school. (stop)
AUGGUUCAAUCGCAGACUUGUAACAGAUUUACGUAC
ReplyDeleteI dream about eat(ing) pizza before Anthropology class in school.
The sentence seems correct but maybe it could have been "at school" instead of "in school". And also you didn't put a random base at the start or the end of your DNA strand. It was very easy for me to locate the start and stop codon.
Hello Johnesha,
ReplyDeleteYou are correct the sentence is I dream about pizza before Anthropology class in school and yeah i made a mistake by not reading the last part of the assignment if i had i would've added more bases before and after the strand. Thanks for the feedback!
Good response and decode, Johnesha.
ReplyDeleteBrian, the coding is good. As noted by Johnesha, you just left off that last set of instructions to include random bases. That was designed to make your decoder look for the start/stop codons to know where to begin and end the translation process. You just made it too easy to decode!
Here is my decode for reference:
DNA: TACCAAGTTAGCGTCTGAACATTGTCTAAATGCATC
RNA/Codons: AUG GUU CAA UCG CAG ACU UGU AAC AGA UUU ACG UAG
(start) I dream about eat(ing) pizza before anthropology class in school. (stop)